Enterprise & entertainment

Testing services trusted by the biggest film studios, production companies and employers in the country


COVID-19 · RSV · INFLUENZA · POLIO ·
& more assays in development
CCCCGTGGGGGATAGTCACCGACGCCGTTTTATAGAAGCCTAGGGGAACAGGTTGGTTTAACTAGCTTAAGAAAGTAAATTCTGGGATTATACTGTAGTAATCACTAATTTACGGTGAGGGTTTTATGGCGGATCTTTACAAATTCAAGCCAGGTGATTTCAACAAATTTTGCTGACGATTTAGGCGCACTATCCCCTAAACTACAAATTAGAAAATAGCGTTCCTTGACGGCTAGAATTACCTACCGGCCTCCACCATACCTTCGATATTCGCGCCCACTCTCCCATTAATCCGCACAAGTGGATGTGATGCGATTGCCCGCTAAGATATTCTAACGTGTAACGCAGATGAGTATTCTACAGAGTTGCCGTACGCGTTGAACACTTCACGGATGATAGGAATTTGCGTATAGAGCGTGTCATTGAGGGGTTATACACCCGTAGACTACAACGGGCCCGGCTCAATCAGAACTCGAGTGCCTTGAATAACATACTCATCACTAAACATTCTCAACAGTCAATCGAGCAAGTCCATTATCAACGAGTGTGTTGCAGTTTTATTCTCTCGCCAGCATTGTAATAGGCACTAAAAGAGTGATGATAGTCATGAGTGCTGAGCTAAGACGGCGTCGGTGCATAGCGGACTTTCGGTCAGTCGCAATTCCTCACGAGACCCGTCCTGTTGAGCGTATCACTCTCAATGTACAAGCAACCCGAGAAGGCTGTGCCTGGACTCAACCGGATGCAGGATGGACTCCAGACACGGGGCCACCACTCTTCACACGTAAAGCAAGAACGTCGAGCAGTCATGAAAGTCTTAGTACCGCACGTGCCATCTTACTGCGAATATTGCCTGAAGCTGTACCGTTATTGGGGGGCAAAGATGAAGTTCTCCTCTTTTCATAATTGTACTGACGACAGCCGTGTTCCCGGTTTCTTCAGAGGTTAAAGAATAAGGGCTTATTGTAGGCAGAGGGACGCCCTTTTAGTGGCTGGCGTTCCCCGTGGGGGATAGTCACCGACGCCGTTTTATAGAAGCCTAGGGGAACAGGTTGGTTTAACTAGCTTAAGAAAGTAAATTCTGGGATTATACTGTAGTAATCACTAATTTACGGTGAGGGTTTTATGGCGGATCTTTACAAATTCAAGCCAGGTGATTTCAACAAATTTTGCTGACGATTTAGGCGCACTATCCCCTAAACTACAAATTAGAAAATAGCGTTCCTTGACGGCTAGAATTACCTACCGGCCTCCACCATACCTTCGATATTCGCGCCCACTCTCCCATTAATCCGCACAAGTGGATGTGATGCGATTGCCCGCTAAGATATTCTAACGTGTAACGCAGATGAGTATTCTACAGAGTTGCCGTACGCGTTGAACACTTCACGGATGATAGGAATTTGCGTATAGAGCGTGTCATTGAGGGGTTATACACCCGTAGACTACAACGGGCCCGGCTCAATCAGAACTCGAGTGCCTTGAATAACATACTCATCACTAAACATTCTCAACAGTCAATCGAGCAAGTCCATTATCAACGAGTGTGTTGCAGTTTTATTCTCTCGCCAGCATTGTAATAGGCACTAAAAGAG CCCCGTGGGGGATAGTCACCGACGCCGTTTTATAGAAGCCTAGGGGAACAGGTTGGTTTAACTAGCTTAAGAAAGTAAATTCTGGGATTATACTGTAGTAATCACTAATTTACGGTGAGGGTTTTATGGCGGATCTTTACAAATTCAAGCCAGGTGATTTCAACAAATTTTGCTGACGATTTAGGCGCACTATCCCCTAAACTACAAATTAGAAAATAGCGTTCCTTGACGGCTAGAATTACCTACCGGCCTCCACCATACCTTCGATATTCGCGCCCACTCTCCCATTAATCCGCACAAGTGGATGTGATGCGATTGCCCGCTAAGATATTCTAACGTGTAACGCAGATGAGTATTCTACAGAGTTGCCGTACGCGTTGAACACTTCACGGATGATAGGAATTTGCGTATAGAGCGTGTCATTGAGGGGTTATACACCCGTAGACTACAACGGGCCCGGCTCAATCAGAACTCGAGTGCCTTGAATAACATACTCATCACTAAACATTCTCAACAGTCAATCGAGCAAGTCCATTATCAACGAGTGTGTTGCAGTTTTATTCTCTCGCCAGCATTGTAATAGGCACTAAAAGAGTGATGATAGTCATGAGTGCTGAGCTAAGACGGCGTCGGTGCATAGCGGACTTTCGGTCAGTCGCAATTCCTCACGAGACCCGTCCTGTTGAGCGTATCACTCTCAATGTACAAGCAACCCGAGAAGGCTGTGCCTGGACTCAACCGGATGCAGGATGGACTCCAGACACGGGGCCACCACTCTTCACACGTAAAGCAAGAACGTCGAGCAGTCATGAAAGTCTTAGTACCGCACGTGCCATCTTACTGCGAATATTGCCTGAAGCTGTACCGTTATTGGGGGGCAAAGATGAAGTTCTCCTCTTTTCATAATTGTACTGACGACAGCCGTGTTCCCGGTTTCTTCAGAGGTTAAAGAATAAGGGCTTATTGTAGGCAGAGGGACGCCCTTTTAGTGGCTGGCGTTCCCCGTGGGGGATAGTCACCGACGCCGTTTTATAGAAGCCTAGGGGAACAGGTTGGTTTAACTAGCTTAAGAAAGTAAATTCTGGGATTATACTGTAGTAATCACTAATTTACGGTGAGGGTTTTATGGCGGATCTTTACAAATTCAAGCCAGGTGATTTCAACAAATTTTGCTGACGATTTAGGCGCACTATCCCCTAAACTACAAATTAGAAAATAGCGTTCCTTGACGGCTAGAATTACCTACCGGCCTCCACCATACCTTCGATATTCGCGCCCACTCTCCCATTAATCCGCACAAGTGGATGTGATGCGATTGCCCGCTAAGATATTCTAACGTGTAACGCAGATGAGTATTCTACAGAGTTGCCGTACGCGTTGAACACTTCACGGATGATAGGAATTTGCGTATAGAGCGTGTCATTGAGGGGTTATACACCCGTAGACTACAACGGGCCCGGCTCAATCAGAACTCGAGTGCCTTGAATAACATACTCATCACTAAACATTCTCAACAGTCAATCGAGCAAGTCCATTATCAACGAGTGTGTTGCAGTTTTATTCTCTCGCCAGCATTGTAATAGGCACTAAAAGAG

The industry's preferred solution

The Fastest RT-PCR Turn-Around Times Available

Preferred provider for 3 out of the 5 largest studios in America
Quidel Lyra Direct assay with Quantgene's cloud portal
100% accuracy, <0.01% false positive rate
2hr TAT from arrival at lab, 4hr TAT from collection
Runs at 10am and 2pm daily
Real lab-based PCR with 94 samples per run (vs. Cepheid)

Fully Customizable

Mobile Labs that Come to You

24/7 account managers focused on production environments

On-Site Full-Service Testing

A seamless experience with total in-house control and a dedicated team of our own medical professionals.

White-Glove Concierge Service

4am call? Late-night set? We’re there when you need us. From on-site teams to your online portal, our service is tailored for the production environment.

High Volume Pricing

Discounted pricing for high-volume testing needs.

Other Testing Companies Put You at Risk

False Positive Rate

Missed COVID Cases

Missed Days Per Production

Avoided Shut-Down Costs

Quantgene*

0.1%

0%

<1

$46M

Alternatives**

1.5%

5%

12

---

* estimated, historic data from Oct 2020 - March 2021 from entertainment productions covered by Quantgene COVID PROTECT

** averages, based on data from alternative testing provider reported to Quantgene by leading productions and studios

The Only All-Encompassing COVID-19 Solution

Testing

All COVID Testing Formats Available

Quantgene is its own CLIA-certified laboratory therefore we do not rely on 3rd party laboratories. This means we can control the entire testing menu and process from end-to-end with no gaps in service or supply chain.

Get started
Collection formats

COLLECTION FORMATS CUSTOMIZED TO YOUR BUSINESS NEEDS

We believe the best testing solution should fit seamlessly into your workflow. That’s why we offer testing services in any format you require from on-premises labs to at-home self-testing.

Get started
Health and safety
Get started
Employee Portal
Get started
Employer Portal
Get started

RT-PCR

LYRA DIRECT

icon

Best use:
Gold standard diagnostic test for the detection of live virus.
Single gene target: ORF1a

Turn-around time:
<12hours from arrival at lab
STAT option 2 hours from arrival at lab

Accuracy:
100% specificity and 100% sensitivity published performance (oral format)

RT-PCR

TaqPath

icon

Best use:
Gold standard diagnostic test for the detection of live virus.
3 gene targets: ORF1a, ORF1b, N genes.

Turn-around time:
<12hours from arrival at lab

Accuracy:
95% specificity, 96.7% sensitivity

Rapid RT-PCR

Accula

icon

Best use:
SARS-Cov-2 test for the qualitative detection of nucleic acid from the SARS-CoV-2

Turn-around time:
45min from collection to result using portable machines. One specimen at a time per machine.

Accuracy:
100% specificity and 100% sensitivity

Rapid PCR

ID Now

icon

Best use:
For the qualitative detection of nucleic acid from viral RNA.
Can be a good supplement to
RT-PCR testing.

Turn-around time:
15-20 minutes to process specimens using a portable machine. One specimen at a time per machine.

Accuracy:
93.9%specificity, 100% sensitivity

Rapid Antigen

BinaxNow

icon

Best use:
For the detection of viral nucleocapsid protein antigen.
Can be a good supplement to RT-PCR testing.

Turn-around time:
15-20 minutes to process specimens using a cassette.

Accuracy:
88.4% specificity, 100% sensitivity

icon

On-Premises Collection Clinic

icon

On-Premises Clinic & Laboratory

icon

On-Site Testing Events

icon

Walk-In Testing Locations

icon

On-Demand Concierge Testing

icon

At-Home Monitored Collection

On-Premises Collection Clinic

For large manufacturing locations or corporate offices secure your own dedicated on-premises walk-in COVID testing clinic.

Semi-permanent location at any office for walk-in testing


Easily meet updated LA County and Federal mandates


RT-PCR results in as fast as 2 hours
Available S-S, 8am-5pm

On-Premises Clinic & Laboratory

For large manufacturing locations or corporate offices secure your own dedicated on-premises walk-in COVID clinic and RT-PCR mobile laboratory.

Easily meet updated State and Federal mandates with dedicated on-site capacity


RT-PCR results in as little as 4hours
Dedicated on-site and account management teams


Guaranteed supply chain - NEVER fall victim to supply chain failure at the next peak

On-Site Testing Events

For all ad-hoc testing needs, schedule COVID testing services that come to your location.

Order to any location in LA with 48 hour notice


RT-PCR results in as fast as 12hours
Rapid testing results in 15min


Available S-S, 8am-5pm

Walk-In Testing Locations

For all overflow or off-schedule testing needs, staff can stop into any of our walk-in sites.

In 8 major city locations


RT-PCR results in as fast as 12hours


Rapid testing results in 15min


Available S-S, 8am-12pm

On-Demand Concierge Testing

Flexible Concierge home visits in LA and ATL for executives or C-suite when/as needed.

Book within 4 hours for on-demand service


A specialized RN will arrive for discrete testing at home


Available S-S, 8am-10pm

At-Home Monitored Collection

For all remote testing needs, Quantgene offers medically monitored at-home antigen testing.

Staff order tests with us


Schedule collection monitoring with our staff


We will walk the patient through the collection steps and help validate their results

HSS and Medical Oversight

For productions that need reliable and production-experienced medical staff to keep their set safe. We offer an expert team all under one roof.

Team of Health and Safety Supervisors who are trained RNs


Our HSS staff are trained and managed by a medical doctor experienced in production management and COVID safety protocols for large complicated productions.


For productions that need reliable and production-experienced medical staff to keep their set safe.

Keeping Safety Simple for Your Staff

While safety is a priority, testing should be a minimal disruption to your staff. Quantgene’s patient portal app, offers real time test tracking and easy access to all test results.

Test result PDFs


Daily symptom tracking


Vaccine status tracking

COVID Data At Your Fingertips

Quantgene’s employer portal, offers real time test tracking, employee test results, and dashboards to help your team manage safety and compliance easily.

Employee dashboard


Real-time testing status


Test scheduling


Vaccine status


Mobile optimized

QUANTGENE COVID PROTECT IN THE NEWS

Hear From Our Clients

Quantgene provided COVID-19 PCR testing for my feature film in Los Angeles. They sent their nurses and staff to our set three times a week, swabbed everyone quickly, and delivered the results by the next day. We were very happy with their work and I highly recommend them.

Michael R. Williams, Line Producer

Keep your production running. Keep your talent safe.